Home > Products > Product Detail
Nucleoprotein-protein N Probe Nucleoprotein-protein N Probe

Nucleoprotein-protein N Probe

Nucleoprotein-protein N Probe approved by the Chinese Center for Disease Control and Prevention (briefly as China CDC) for rapid identification of the virus.

Catalog
Specification
Quantity
Promotion Code
Special ID
Coupon
Unit Price:

Product name: 

Nucleoprotein-protein N Probe

Description:

Nucleoprotein-protein N Probe approved by the Chinese Center for Disease Control and Prevention (briefly as China CDC) for rapid identification of the virus.

All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures. 

Sequence:

TTGCTGCTGCTTGACAGATT

5' Modification

5'-FAM

3' Modification

3'-BHQ1

Turnaround times for these products may vary due to heavy demand. Expected turnaround time: 5-9 Business days