Free Universal Primers

GENEWIZ offers a variety of free universal primers for sequencing. These free universal primers are being updated to reflect the needs of our customers. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). If you are unsure which CLIMS system you are using, please contact our Technical Support team at 877-GENEWIZ, ext. 2.


Primer not listed? Learn more about GENEWIZ Oligos.

Updated GENEWIZ Universal Primers
Name Length(nt) Sequences(5'-3')

T7

20

TAATACGACTCACTATAGGG

T7 Term

19

GCTAGTTATTGCTCAGCGG

T3

20

ATTAACCCTCACTAAAGGGA

SP6

19

GATTTAGGTGACACTATAG

U6

20

GACTATCATATGCTTACCGT

BGHR

18

TAGAAGGCACAGTCGAGG

M13F

16

GTAAAACGACGGCCAG

M13R

17

CAGGAAACAGCTATGAC

M13-40FOR

17

GTTTTCCCAGTCACGAC

M13-48REV

20

CGGATAACAATTTCACACAG

CMV-Forward

21

CGCAAATGGGCGGTAGGCGTG

5GEX

23

GGGCTGGCAAGCCACGTTTGGTG

3GEX

23

CCGGGAGCTGCATGTGTCAGAGG

pFastBacF

20

GGATTATTCATACCGTCCCA

pFastBacR

20

CAAATGTGGTATGGCTGATT

pBAD Forward

20

ATGCCATAGCATTTTTATCC

pBAD Reverse

18

GATTTAATCTGTATCAGG

EGFP-C-For

22

CATGGTCCTGCTGGAGTTCGTG

EGFP-C-REV

17

GTTCAGGGGGAGGTGTG

EGFP-N

21

CGTCGCCGTCCAGCTCGACCA

SV40pA-R

20

GAAATTTGTGATGCTATTGC

ATTB1

20

GTTTGTACAAAAAAGCAGGC

ATTB2

24

CCACTTTGTACAAGAAAGCTGGGT

ATTL1

24

CGCGTTAACGCTAGCATGGATCTC

ATTL2

20

CATCAGAGATTTTGAGACAC

ITS1

19

TCCGTAGGTGAACCTGCGG

ITS4

20

TCCTCCGCTTATTGATATGC

PJET1-2F

23

CGACTCACTATAGGGAGAGCGGC

PJET1-2R

24

AAGAACATCGATTTTCCATGGCAG

DeepVariant: To Improve and Extend, Use Training not Programming

Wednesday, June 12 · 12:00 PM ET & 4:00 PM ET