Free Universal Primers

GENEWIZ offers a variety of free universal primers for sequencing. These free universal primers are being updated to reflect the needs of our customers. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). If you are unsure which CLIMS system you are using, please contact our Technical Support team at 877-GENEWIZ, ext. 2.


GENEWIZ Legacy Primers
Name Length(nt) Sequences(5'-3')

T7

20

TAATACGACTCACTATAGGG

T7 Term

19

GCTAGTTATTGCTCAGCGG

T7 EEV

Retiring

22

ATGTCGTAATAACCCCGCCCCG

T3

20

ATTAACCCTCACTAAAGGGA

SP6

19

GATTTAGGTGACACTATAG

BGHR

18

TAGAAGGCACAGTCGAGG

M13F(-21)

Redesigned1

18

TGTAAAACGACGGCCAGT

M13F(-47)

Redesigned2

24

CGCCAGGGTTTTCCCAGTCACGAC

M13F(-41)

Redesigned2

18

GGTTTTCCCAGTCACGAC

M13R

17

CAGGAAACAGCTATGAC

CMV-Forward

21

CGCAAATGGGCGGTAGGCGTG

5GEX

23

GGGCTGGCAAGCCACGTTTGGTG

3GEX

23

CCGGGAGCTGCATGTGTCAGAGG

pFastBacF

20

GGATTATTCATACCGTCCCA

pFastBacR

20

CAAATGTGGTATGGCTGATT

pBAD Forward

20

ATGCCATAGCATTTTTATCC

pBAD Reverse

18

GATTTAATCTGTATCAGG

EGFP-C

Renamed*

22

CATGGTCCTGCTGGAGTTCGTG

EGFP-N

21

CGTCGCCGTCCAGCTCGACCA

SV40pA-R

20

GAAATTTGTGATGCTATTGC

SV40-promoter

Retiring

20

TATTTATGCAGAGGCCGAGG

V5

Retiring

21

ACCGAGGAGAGGGTTAGGGAT

Myc

Retiring

24

CATGGTCCTGCTGGAGTTCGTG

Neo-F

Retiring

20

CGTTGGCTACCCGTGATATT

Neo-R

Retiring

20

TGGATACTTTCTCGGCAG

Updated GENEWIZ Universal Primers
Name Length(nt) Sequences(5'-3')

T7

20

TAATACGACTCACTATAGGG

T7 Term

19

GCTAGTTATTGCTCAGCGG

T3

20

ATTAACCCTCACTAAAGGGA

SP6

19

GATTTAGGTGACACTATAG

U6

New!

20

GACTATCATATGCTTACCGT

BGHR

18

TAGAAGGCACAGTCGAGG

M13F

Redesigned1

16

GTAAAACGACGGCCAG

M13R

17

CAGGAAACAGCTATGAC

M13-40FOR

Redesigned2

17

GTTTTCCCAGTCACGAC

M13-48REV

New!

20

CGGATAACAATTTCACACAG

CMV-Forward

21

CGCAAATGGGCGGTAGGCGTG

5GEX

23

GGGCTGGCAAGCCACGTTTGGTG

3GEX

23

CCGGGAGCTGCATGTGTCAGAGG

pFastBacF

20

GGATTATTCATACCGTCCCA

pFastBacR

20

CAAATGTGGTATGGCTGATT

pBAD Forward

20

ATGCCATAGCATTTTTATCC

pBAD Reverse

18

GATTTAATCTGTATCAGG

EGFP-C-For

Renamed*

22

CATGGTCCTGCTGGAGTTCGTG

EGFP-C-REV

New!

17

GTTCAGGGGGAGGTGTG

EGFP-N

21

CGTCGCCGTCCAGCTCGACCA

SV40pA-R

20

GAAATTTGTGATGCTATTGC

ATTB1

New!

20

GTTTGTACAAAAAAGCAGGC

ATTB2

New!

24

CCACTTTGTACAAGAAAGCTGGGT

ATTL1

New!

24

CGCGTTAACGCTAGCATGGATCTC

ATTL2

New!

20

CATCAGAGATTTTGAGACAC

ITS1

New!

19

TCCGTAGGTGAACCTGCGG

ITS4

New!

20

TCCTCCGCTTATTGATATGC

PJET1-2F

New!

23

CGACTCACTATAGGGAGAGCGGC

PJET1-2R

New!

24

AAGAACATCGATTTTCCATGGCAG

* EGFP-C was renamed EGFP-C-For

1 M13F(-21) was redesigned and renamed M13F

2 Overlapping M13F(-47) and M13F(-41) were reduced to a single primer named M13-40FOR