SNP Genotyping

Genotyping is a method used to determine the genetic makeup of an organism. This method identifies genetic variations by comparing an individual’s sequence against a wild-type reference sequence to analyze single nucleotide polymorphisms (SNPs). SNPs are present in both the coding and non-coding regions of a gene and are one of the most common types of variants; they are represented as a single nucleotide mutation within a DNA sequence.

GENEWIZ’s SNP Genotyping service is a PCR and Sanger sequencing-based solution that is used to ramp up SNP screening assays and validate SNPs of interest with speed and accuracy.


Request Quote   

Get 25% off your first SNP Genotyping order for a limited time only

SNP Genotyping Analysis and Detection

SNP analysis and identification may help predict an individual’s response to certain drugs, susceptibility to environmental factors, and risk for developing diseases. Alternatively, SNPs can be used to track inheritance of disease genes within families and provide insight into SNP linkage.

Sanger sequencing-based SNP genotyping can be performed on a small subset of samples or as part of large-scale projects. Whether you are using genotyping as your primary approach for SNP analysis and detection, or to confirm next generation sequencing and microarray results, GENEWIZ can help accelerate your project. Let the Sanger sequencing experts at GENEWIZ support your SNP genotyping research objectives with speed, quality, and reliability.




Service Highlights

SNP GENOTYPING
Starting Material gDNA (extractions available)
Assay Coverage Annotated SNPs of interest
Confirm SNPs
Deliverables/Reports Raw data files: .ab1, .seq
Nucleotide level mutations 

*Customized reports available


Looking to identify non-annotated mutations in coding or non-coding regions of interest? See GENEWIZ’s Mutation Analysis service.

Features & Benefits

Reliable Assay Development: Our highly-trained scientists develop robust and reproducible PCR assays targeted to your SNPs of interest.


High-Throughput Processing: Target SNPs are amplified using optimized assays; amplicons are purified and efficiently sequenced by capillary electrophoresis in our high-throughput facility.
Accurate Data Analysis: SNP are identified by software programs and confirmed by GENEWIZ scientists to ensure accuracy of the reported data. GENEWIZ will provide a report with nucleotide level findings. Customizable reports are available upon request for a complete start-to-finish solution.
Developed Assay Lists: Clients can store assays with GENEWIZ and re-order them over time from a dynamic assay list that will be built to fit each client’s research needs.

GENEWIZ SNP GENOTYPING WORKFLOW

1. PROJECT CONSULTATION & PRIMER DESIGN

Amplicon selection and primer design to targeted SNPs of interest

2. ASSAY DEVELOPMENT

Optimization of project-specific samples

3. PCR & PURIFICATION

PCR amplification of genomic DNA using optimized conditions

4. SEQUENCING & DATA ANALYSIS

Bi-directional DNA sequencing per amplicon and final report identifying SNPs

GENEWIZ vs. In-House

SNP Genotyping Turnaround Time Comparison: GENEWIZ versus In-house

GENEWIZ TURNAROUND: 5 DAYS

IN-HOUSE TURNAROUND: 2-4 WEEKS



Deliverables

All SNP Genotyping projects will receive a raw data file (Figure 1.) along with a final report identifying SNPs compared to the provided reference sequence (Figure 2.). Custom reports are also available upon request.

Example: BRAF c.1799T>A (V600E) Mutation in Melanoma

Mutations in BRAF are largely linked to malignant melanomas. Mutations at BRAF V600 are common indicators for responsiveness to treatment for melanoma patients.

Figure 1. Chromatogram
Chromatogram showing the heterozygous mutation at nucleotide position 1799 (T to A mutation at position 16 below) which correlates to amino acid position 600 (V to E mutation).


Figure 2. Final Report

A SNP genotyping final report shows the reference SNP ID number, the allelic mutation, and the flanking sequence with the highlighted position of the identified SNP.

SNP ID Alelles Flanking Sequence
rs113488022 T/A TTGGTCTAGCTACAGTGAAATCTCGATGGAG

Related Services

HOW TO ORDER

*Samples must arrive at the GENEWIZ New Jersey Laboratory before 10:00 am EST to qualify for Same Day service. Note that direct-sequencing templates are not available for our Same Day service.

Email | Phone (1-877-GENEWIZ (436-3949), Ext. 3350)