Product name:
2019-nCoV_N1 Forward Primer
Description:
2019-nCoV_N1 Forward Primer approved by the Centers for Disease Control and Prevention (CDC).
All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures.
Sequence:
GACCCCAAAATCAGCGAAAT
Turnaround times for these products may vary due to heavy demand. Expected turnaround time: 5-9 Business days