Home > Products > Product Detail
2019-nCoV_N2 Forward Primer 2019-nCoV_N2 Forward Primer

2019-nCoV_N2 Forward Primer

2019-nCoV_N2 Forward Primer approved by the Centers for Disease Control and Prevention (CDC)

Catalog
Specification
Quantity
Promotion Code
Special ID
Coupon
Unit Price:

Product name: 

2019-nCoV_N2 Forward Primer

Description:

2019-nCoV_N2 Forward Primer approved by the Centers for Disease Control and Prevention (CDC).

All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures. 

Sequence:

TTACAAACATTGGCCGCAAA

Turnaround times for these products may vary due to heavy demand. Expected turnaround time: 5-9 Business days