Home > Products > Product Detail
RdRP gene P2 Primer & Probe set RdRP gene P2 Primer & Probe set

RdRP gene P2 Primer & Probe set

RdRP Probe and Primer approved by the World Health Organization (WHO) for rapid identification of the virus. For Research Use Only - Not for use in diagnostic procedures.

Catalog
Specification
Quantity
Promotion Code
Special ID
Coupon
Unit Price:

This set includes three items: RdRP Probe P2, RdRP Forward Primer and RdRP Reverse Primer.

Product name: 

RdRP Probe

Description:

RdRP Probe approved by the World Health Organization (WHO) for rapid identification of the virus.

All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures. 

Sequence:

CAGGTGGAACCTCATCAGGAGATGC

5' Modification

5'-FAM

3' Modification

3'-BHQ1

 

Product name: 

RdRP Forward Primer

Description:

RdRP Forward Primer approved by the World Health Organization (WHO) for rapid identification of the virus.

All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures. 

Sequence:

GTGARATGGTCATGTGTGGCGG

 

Product name: 

RdRP Reverse Primer

Description:

RdRP Reverse Primer approved by the World Health Organization (WHO) for rapid identification of the virus.

All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures. 

Sequence:

CARATGTTAAASACACTATTAGCATA

Turnaround times for these products may vary due to heavy demand. Expected turnaround time: 5-9 Business days