Product name:
E gene Reverse Primer
Description:
E gene Reverse Primer approved by the World Health Organization (WHO) for rapid identification of the virus.
All primers and probes are HPLC purified. If desalted primers are needed, please log in to your GENEWIZ account and navigate to Oligo Synthesis Service to place the order. For Research Use Only - Not for use in diagnostic procedures.
Sequence:
ATATTGCAGCAGTACGCACACA
Turnaround times for these products may vary due to heavy demand. Expected turnaround time: 5-9 Business days